JRF NET Life Sciences June 2018 Model Question Paper 18

NET June 2018 Mock Test

NET Life Sciences Old Papers NET Life Sciences Mock Test

Welcome to Life Sciences CSIR Mock Test 18

This Mock Test consists of 15 questions in MCQ format. At the end of the mock test, you have to click on the 'SUBMIT' button to see your Score and the Correct Answers

Please click on the 'NEXT' button to Start the Mock Test...


Which of the following statement is correct regarding meiotic cell division?


The pitcher plant Nepenthes would be expected to have:


Oxygen and carbon dioxide pass through the plasma membrane by:


Major regulatory step in the cholesterol biosynthesis pathway is:


The possible combination of gametes which can be formed by the genotype AaBbCcDdEeFfGg are:


The concentration of which of the following ion is responsible for the resting potential of the plasma membrane?


Consider the following DNA sequence 5’ATGGGCATAGACGATATGGTAG3’. If due to frame-shift mutation there is insertion of G between 3rd and 4th position. Consider a reverse mutation occur in same mutated sequence. Which reverse mutation will have minimum effect in protein change?


Major cause of evolution of genes and proteins is:


The most important cation source in the cell lumen is:


In a normal cell, the phosphatidylserine residues are located at the:


With time the molecular distance between organisms increases during evolution due to:


Glucose transporter in the membrane is an example for:


Which of the following monochromatic lights are more suitable for plant growth?


A tryptophan auxotroph in corn showed 50 times more accumulation of IAA than the normal. Probable explanation for this is:


What is the average resting potential of a mammalian neuron?

You have reached at the End of this Mock Test.

Please Click 'SUBMIT' button to see your Score and the Correct Answers...

More Online Mock Tests… Please follow the links below…


Get our Updates on CSIR NET Life Sciences in your E-mail Inbox
We will not spam your account…

Enter your e-mail address

Don’t forget to Activate your Subscription…. Please See Your E-Mail…

Browse more in Easy Biology Class…

Lecture NotesBiology PPTVideo TutorialsBiology MCQQuestion BankDifference betweenPractical AidsMock Tests (MCQ)Biology Exams

If you like this post, Please COMMENT . . . . (below ↓)

Please Share with your Friends, Relatives, Students and Colleagues…

Posted in CSIR / ICMR / DBT / ICAR, CSIR NET Mock Test, CSIR NET Model Questions, Mock (Practice) Tests and tagged , , .

Leave a Reply

Your email address will not be published. Required fields are marked *