Biotechnology Eligibility Test 2019 (Mock Test-02)


dbt bet jrf 2019 question paper


You may also like…

DBT BET JRF Previous Year Solved Question Papers (Download PDF)

Welcome to DBT BET JRF Mock Test 02

DBT Biotechnology Eligibility Test 2019: Model Question Paper 2

This question set on DBT BET JRF 2019 Mock Test 02 consists of 15 questions in MCQ format. Please select the correct answer and at the end of the test, you have to click 'SUBMIT' button to see your Score and the Correct Answers. 

Please click 'NEXT' button to start the quiz...

1. Maximum possible isomers for glucose are
2. Which of the following is not a co‐dominant marker?
3. A test to determine whether two mutant sites of a gene are in the same functional unit or gene:
4. A molecular marker cannot be utilized for:
5. Consider the following DNA sequence 5’ATGGGCATAGACGATATGGTAG3’. If due to frame-shift mutation there is an insertion of G between 3rd and 4th position. Consider a reverse mutation occur in the same mutated sequence. Which reverse mutation will have minimum effect in protein change?
6. Among the following which would be the most suitable marker for the selection of animals with agronomic traits:
7. Alu elements are:
8. Albinos have a visual problem in bright light because they lack:
9. During transposition, transposons are excised by:
10. A mutation changes the codon in such a way that there is no effect on functioning and overall structure of the protein. This type of mutation is termed as:
11. The type of mutation which is most suitable for studying the regulation of DNA replication is:
12. Interspecific hybrids have proved very useful for:
13. Which of the following is a Triplet Repeat disorder?
14. Two species A and B were hybridized to form species C. Which of the following techniques can be used to confirm that the resultant species C is a hybrid?
15. Ames test is performed to detect:

You have reached at the End of this Quiz.

Please Click 'SUBMIT' button to see your Score and the Correct Answers...






DBT BET JRF Previous Year Solved Question Papers

@. DBT BET JRF 2018 (Solved Paper)

@. DBT BET JRF  2017 (Solved Paper)

@. DBT BET JRF 2016 (Solved Paper)

@. DBT BET JRF 2015 (Solved Paper)

@. DBT BET JRF 2014 (Solved Paper)

@. DBT BET JRF 2013 (Solved Paper)

@. DBT BET JRF 2012 (Solved Paper)

@. DBT BET JRF 2011 (Solved Paper)

@. DBT BET JRF 2010 (Solved Paper)

@. DBT BET JRF 2009 (Solved Paper)

@. DBT BET JRF 2008 (Solved Paper)


More Online Mock Tests… Please follow the links below…

CSIR JRF NETICMR JRFDBT BET JRFGATE - BTGATE XL Bioche.GATE XL Micro.GATE XL BotanyGATE XL ZoologyGATE XL Food Tec.GATE EY EcologyIIT JAM - BTIIT JAM - BLGS - BiologySET - BotanySET - ZoologyNEET


Get our Updates on DBT BET Mock Tests in your E-mail Inbox
We will not spam your account…

Enter your e-mail address


Don’t forget to Activate your Subscription…. Please See Your E-Mail…


Browse more in Easy Biology Class…

Lecture NotesBiology PPTVideo TutorialsBiology MCQQuestion BankDifference betweenPractical AidsMock Tests (MCQ)Biology Exams


If you like this post, Please COMMENT . . . . (below ↓)

Please Share with your Friends, Relatives, Students and Colleagues…

Facebooktwittergoogle_pluspinterestlinkedin
Posted in Biology Quizzes, Biotechnology, Biotechnology Ph.D Entrance, DBT BET Exam, Mock (Practice) Tests, Ph.D Entrance Test and tagged , , , , , .

Leave a Reply

Your email address will not be published. Required fields are marked *